Review



plasmids expressing cas9 pdd162  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Addgene inc plasmids expressing cas9 pdd162
    Plasmids Expressing Cas9 Pdd162, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 258 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+expressing+cas9+++empty+sgrna/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pm41896213-178-26-31
    Average 95 stars, based on 258 article reviews
    plasmids expressing cas9 pdd162 - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: Cell signaling facilitates apical constriction by basolaterally recruiting Arp2/3 via Rac and WAVE.
    Article Snippet: In the plasmid-based method, repair templates were constructed by integrating homology arm PCR products, which were amplified from worm genomic DNA, into vectors containing a fluorescent protein and a selection cassette using Gibson Assembly (New England Biolabs), as thoroughly detailed by Dickinson et al. (2015). .. Cas9 guide sequences were inserted into the Cas9-sgRNA expression vector pDD162, RRID: Addgene_47549, and coinjected into the adult germlines along with the repair template vector and arraymarkers. ..

    Article Title: Functionally non-redundant paralogs spe-47 and spe-50 encode FB-MO associated proteins and interact with him-8
    Article Snippet: .. To create a mutation that replicates the spe-47(hc198) amino acid substitution in spe-50 , we utilized the expression vector pDD162, which has both a single guide RNA (sgRNA) backbone and the Cas9 gene for C . elegans expression [ ] (obtained from Addgene). ..

    Article Title: Reduction of Derlin activity suppresses Notch-dependent tumours in the C. elegans germ line
    Article Snippet: The dpy-10(cn64) oligo repair template was synthesized by IDT as 4nm Ultramer DNA Oligo and was used at 0.5µM final concentration for injections. .. The Cas9 expressing plasmid, pDD162 (Addgene #47549), was used at a final concentration of 50ng/μl ( ). ..

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4 μl nuclease-free duplex buffer, 0.5 μl Cas9 (IDT, stock 10 μg/μl), 0.9 μl tracrRNA (IDT, stock 100 μM) and 2.8 μl crRNA (IDT, stock 34 μM, see Supplementary Table for sequences) were pipetted together and gently mixed.

    Article Title: Reduction of Derlin activity suppresses Notch-dependent tumours in the C . elegans germ line
    Article Snippet: The dpy-10(cn64) oligo repair template was synthesized by IDT as 4nm Ultramer DNA Oligo and was used at 0.5μM final concentration for injections. .. The Cas9 expressing plasmid, pDD162 (Addgene #47549), was used at a final concentration of 50ng/μl [ ]. ..


    Article Title: Caenorhabditis elegans SEL-5/AAK1 regulates cell migration and cell outgrowth independently of its kinase activity
    Article Snippet: 647 bp upstream of sel-5 ATG (5' homology arm) and 558 bp sel-5 genomic sequence starting from ATG (3' homology arm) were PCR-amplified from N2 genomic DNA with primers harbouring overhangs for Gibson assembly with the pDD282 vector ( ; a gift from Bob Goldstein [Addgene plasmid # 66823; http://n2t.net/addgene :66823; RRID: Addgene_66823] ) and assembled with pDD282 digested with ClaI and SpeI. .. Sequence GCTGAAAAGCCCTAGAGGCA was inserted into pDD162 vector for sgRNA expression ( ; pDD162 was a gift from Bob Goldstein [Addgene plasmid # 47549; http://n2t.net/addgene :47549; RRID: Addgene_47549] ). ..

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair.
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4μl nuclease-free duplex buffer, 0.5μl Cas9 (IDT, stock 10μg/μl), 0.9μl tracrRNA (IDT, stock 100μM) and 2.8μl crRNA (IDT, stock 34μM, see Supplementary Table 3 for sequences) were pipetted together and gently mixed.

    Mutagenesis:

    Article Title: Functionally non-redundant paralogs spe-47 and spe-50 encode FB-MO associated proteins and interact with him-8
    Article Snippet: .. To create a mutation that replicates the spe-47(hc198) amino acid substitution in spe-50 , we utilized the expression vector pDD162, which has both a single guide RNA (sgRNA) backbone and the Cas9 gene for C . elegans expression [ ] (obtained from Addgene). ..


    Plasmid Preparation:

    Article Title: Functionally non-redundant paralogs spe-47 and spe-50 encode FB-MO associated proteins and interact with him-8
    Article Snippet: .. To create a mutation that replicates the spe-47(hc198) amino acid substitution in spe-50 , we utilized the expression vector pDD162, which has both a single guide RNA (sgRNA) backbone and the Cas9 gene for C . elegans expression [ ] (obtained from Addgene). ..

    Article Title: Reduction of Derlin activity suppresses Notch-dependent tumours in the C. elegans germ line
    Article Snippet: The dpy-10(cn64) oligo repair template was synthesized by IDT as 4nm Ultramer DNA Oligo and was used at 0.5µM final concentration for injections. .. The Cas9 expressing plasmid, pDD162 (Addgene #47549), was used at a final concentration of 50ng/μl ( ). ..

    Article Title: Reduction of Derlin activity suppresses Notch-dependent tumours in the C . elegans germ line
    Article Snippet: The dpy-10(cn64) oligo repair template was synthesized by IDT as 4nm Ultramer DNA Oligo and was used at 0.5μM final concentration for injections. .. The Cas9 expressing plasmid, pDD162 (Addgene #47549), was used at a final concentration of 50ng/μl [ ]. ..


    Article Title: Caenorhabditis elegans SEL-5/AAK1 regulates cell migration and cell outgrowth independently of its kinase activity
    Article Snippet: 647 bp upstream of sel-5 ATG (5' homology arm) and 558 bp sel-5 genomic sequence starting from ATG (3' homology arm) were PCR-amplified from N2 genomic DNA with primers harbouring overhangs for Gibson assembly with the pDD282 vector ( ; a gift from Bob Goldstein [Addgene plasmid # 66823; http://n2t.net/addgene :66823; RRID: Addgene_66823] ) and assembled with pDD282 digested with ClaI and SpeI. .. Sequence GCTGAAAAGCCCTAGAGGCA was inserted into pDD162 vector for sgRNA expression ( ; pDD162 was a gift from Bob Goldstein [Addgene plasmid # 47549; http://n2t.net/addgene :47549; RRID: Addgene_47549] ). ..

    Concentration Assay:

    Article Title: Reduction of Derlin activity suppresses Notch-dependent tumours in the C. elegans germ line
    Article Snippet: The dpy-10(cn64) oligo repair template was synthesized by IDT as 4nm Ultramer DNA Oligo and was used at 0.5µM final concentration for injections. .. The Cas9 expressing plasmid, pDD162 (Addgene #47549), was used at a final concentration of 50ng/μl ( ). ..

    Article Title: Reduction of Derlin activity suppresses Notch-dependent tumours in the C . elegans germ line
    Article Snippet: The dpy-10(cn64) oligo repair template was synthesized by IDT as 4nm Ultramer DNA Oligo and was used at 0.5μM final concentration for injections. .. The Cas9 expressing plasmid, pDD162 (Addgene #47549), was used at a final concentration of 50ng/μl [ ]. ..

    CRISPR:

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4 μl nuclease-free duplex buffer, 0.5 μl Cas9 (IDT, stock 10 μg/μl), 0.9 μl tracrRNA (IDT, stock 100 μM) and 2.8 μl crRNA (IDT, stock 34 μM, see Supplementary Table for sequences) were pipetted together and gently mixed.

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair.
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4μl nuclease-free duplex buffer, 0.5μl Cas9 (IDT, stock 10μg/μl), 0.9μl tracrRNA (IDT, stock 100μM) and 2.8μl crRNA (IDT, stock 34μM, see Supplementary Table 3 for sequences) were pipetted together and gently mixed.

    Injection:

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4 μl nuclease-free duplex buffer, 0.5 μl Cas9 (IDT, stock 10 μg/μl), 0.9 μl tracrRNA (IDT, stock 100 μM) and 2.8 μl crRNA (IDT, stock 34 μM, see Supplementary Table for sequences) were pipetted together and gently mixed.

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair.
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4μl nuclease-free duplex buffer, 0.5μl Cas9 (IDT, stock 10μg/μl), 0.9μl tracrRNA (IDT, stock 100μM) and 2.8μl crRNA (IDT, stock 34μM, see Supplementary Table 3 for sequences) were pipetted together and gently mixed.

    Marker:

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4 μl nuclease-free duplex buffer, 0.5 μl Cas9 (IDT, stock 10 μg/μl), 0.9 μl tracrRNA (IDT, stock 100 μM) and 2.8 μl crRNA (IDT, stock 34 μM, see Supplementary Table for sequences) were pipetted together and gently mixed.

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair.
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4μl nuclease-free duplex buffer, 0.5μl Cas9 (IDT, stock 10μg/μl), 0.9μl tracrRNA (IDT, stock 100μM) and 2.8μl crRNA (IDT, stock 34μM, see Supplementary Table 3 for sequences) were pipetted together and gently mixed.

    Modification:

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4 μl nuclease-free duplex buffer, 0.5 μl Cas9 (IDT, stock 10 μg/μl), 0.9 μl tracrRNA (IDT, stock 100 μM) and 2.8 μl crRNA (IDT, stock 34 μM, see Supplementary Table for sequences) were pipetted together and gently mixed.

    Article Title: TONSL suppresses polymerase theta-dependent tandem duplications through chromatin-guided repair.
    Article Snippet: .. For CRISPR/Cas9-mediated targeting, we created injection mixes containing RNP complexes in combination with repair templates (ssODNs) and co-injection marker plasmids, or we created injection mixes containing plasmids expressing Cas9 pDD162 (Peft-3::Cas9, Addgene 47549) and an sgRNA pJJR50 (u6::sgRNA with modified target). .. The RNP mix was prepared as follows: 4μl nuclease-free duplex buffer, 0.5μl Cas9 (IDT, stock 10μg/μl), 0.9μl tracrRNA (IDT, stock 100μM) and 2.8μl crRNA (IDT, stock 34μM, see Supplementary Table 3 for sequences) were pipetted together and gently mixed.

    Sequencing:

    Article Title: Caenorhabditis elegans SEL-5/AAK1 regulates cell migration and cell outgrowth independently of its kinase activity
    Article Snippet: 647 bp upstream of sel-5 ATG (5' homology arm) and 558 bp sel-5 genomic sequence starting from ATG (3' homology arm) were PCR-amplified from N2 genomic DNA with primers harbouring overhangs for Gibson assembly with the pDD282 vector ( ; a gift from Bob Goldstein [Addgene plasmid # 66823; http://n2t.net/addgene :66823; RRID: Addgene_66823] ) and assembled with pDD282 digested with ClaI and SpeI. .. Sequence GCTGAAAAGCCCTAGAGGCA was inserted into pDD162 vector for sgRNA expression ( ; pDD162 was a gift from Bob Goldstein [Addgene plasmid # 47549; http://n2t.net/addgene :47549; RRID: Addgene_47549] ). ..



    Similar Products

    plasmids expressing cas9 pdd162  (Addgene inc)
    95
    Addgene inc plasmids expressing cas9 pdd162
    Plasmids Expressing Cas9 Pdd162, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+expressing+cas9+++empty+sgrna/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pm41896213-178-26-31
    Average 95 stars, based on 1 article reviews
    plasmids expressing cas9 pdd162 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    plasmid expressing cas9 + empty sgrna  (Addgene inc)
    90
    Addgene inc plasmid expressing cas9 + empty sgrna
    Plasmid Expressing Cas9 + Empty Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+expressing+cas9+++empty+sgrna/px330+u6+chimeric+bb+cbh+hspcas9/pm40624357-302-59-70
    Average 90 stars, based on 1 article reviews
    plasmid expressing cas9 + empty sgrna - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    cas9 sgrna expression vector pdd162 rrid addgene 47549  (Addgene inc)
    95
    Addgene inc cas9 sgrna expression vector pdd162 rrid addgene 47549
    Cas9 Sgrna Expression Vector Pdd162 Rrid Addgene 47549, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+expressing+cas9+++empty+sgrna/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pm40042443-275-7-12
    Average 95 stars, based on 1 article reviews
    cas9 sgrna expression vector pdd162 rrid addgene 47549 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    cas9 worm expression plasmid  (Addgene inc)
    95
    Addgene inc cas9 worm expression plasmid
    (A) Schematic representation of the sqt-3 coding strand from amino acid residues 153 to 169, with the wild-type sequence on top and the edited sequence at the bottom. The sc63 mutation (G161E) is indicated in red. The gRNA sequences are marked with black arrows, and the adjacent PAM sequences are underlined. Additional silent mutations introduced by the single-stranded DNA repair template create SfoI or HaeII restriction sites for ease of screening, which are highlighted with a yellow background. Silent mutations introduced to disrupt gRNA complementarity and prevent re-editing are shown in blue. The expected <t>Cas9</t> cleavage sites are marked by vertical red dashed lines. (B) Representative images of Roller (left), Dumpy (middle), and Dumpy/Roller (right) phenotypes in F1 adult progeny of injected animals grown at 25°C. Individuals with the corresponding phenotype were placed in proximity to each other for imaging. Images were captured using a Leica DFC3000 G camera with a 20x objective. Scale bar: 1500 µm. (C) Summary of editing efficiency with each gRNA. About 20 animals were injected for each condition, resulting in 6–9 individuals producing edited F1 offspring at 25°C. (D) Alignment of SQT-3 amino acid residues 153–169 of C. elegans (Cel) to the homologous proteins in C. brenneri (Cbn), C. briggsae (Cbr), C. nigoni (Cni), C. remanei (Cre), C. japonica (Cja), C. tropicalis (Ctr), and P. pacificus (Ppa). Protein alignments were generated using SnapGene with default settings. The C. elegans residue G161 mutated in sc63 is highlighted with a red box.
    Cas9 Worm Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+expressing+cas9+++empty+sgrna/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pmc11868924-55-1-18
    Average 95 stars, based on 1 article reviews
    cas9 worm expression plasmid - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    cas9 expression plasmid pdd162  (Addgene inc)
    95
    Addgene inc cas9 expression plasmid pdd162
    (A) Schematic representation of the sqt-3 coding strand from amino acid residues 153 to 169, with the wild-type sequence on top and the edited sequence at the bottom. The sc63 mutation (G161E) is indicated in red. The gRNA sequences are marked with black arrows, and the adjacent PAM sequences are underlined. Additional silent mutations introduced by the single-stranded DNA repair template create SfoI or HaeII restriction sites for ease of screening, which are highlighted with a yellow background. Silent mutations introduced to disrupt gRNA complementarity and prevent re-editing are shown in blue. The expected <t>Cas9</t> cleavage sites are marked by vertical red dashed lines. (B) Representative images of Roller (left), Dumpy (middle), and Dumpy/Roller (right) phenotypes in F1 adult progeny of injected animals grown at 25°C. Individuals with the corresponding phenotype were placed in proximity to each other for imaging. Images were captured using a Leica DFC3000 G camera with a 20x objective. Scale bar: 1500 µm. (C) Summary of editing efficiency with each gRNA. About 20 animals were injected for each condition, resulting in 6–9 individuals producing edited F1 offspring at 25°C. (D) Alignment of SQT-3 amino acid residues 153–169 of C. elegans (Cel) to the homologous proteins in C. brenneri (Cbn), C. briggsae (Cbr), C. nigoni (Cni), C. remanei (Cre), C. japonica (Cja), C. tropicalis (Ctr), and P. pacificus (Ppa). Protein alignments were generated using SnapGene with default settings. The C. elegans residue G161 mutated in sc63 is highlighted with a red box.
    Cas9 Expression Plasmid Pdd162, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+expressing+cas9+++empty+sgrna/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pmc11397494-192-35-42
    Average 95 stars, based on 1 article reviews
    cas9 expression plasmid pdd162 - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    sgrna expression  (Addgene inc)
    95
    Addgene inc sgrna expression
    (A) Schematic representation of the sqt-3 coding strand from amino acid residues 153 to 169, with the wild-type sequence on top and the edited sequence at the bottom. The sc63 mutation (G161E) is indicated in red. The gRNA sequences are marked with black arrows, and the adjacent PAM sequences are underlined. Additional silent mutations introduced by the single-stranded DNA repair template create SfoI or HaeII restriction sites for ease of screening, which are highlighted with a yellow background. Silent mutations introduced to disrupt gRNA complementarity and prevent re-editing are shown in blue. The expected <t>Cas9</t> cleavage sites are marked by vertical red dashed lines. (B) Representative images of Roller (left), Dumpy (middle), and Dumpy/Roller (right) phenotypes in F1 adult progeny of injected animals grown at 25°C. Individuals with the corresponding phenotype were placed in proximity to each other for imaging. Images were captured using a Leica DFC3000 G camera with a 20x objective. Scale bar: 1500 µm. (C) Summary of editing efficiency with each gRNA. About 20 animals were injected for each condition, resulting in 6–9 individuals producing edited F1 offspring at 25°C. (D) Alignment of SQT-3 amino acid residues 153–169 of C. elegans (Cel) to the homologous proteins in C. brenneri (Cbn), C. briggsae (Cbr), C. nigoni (Cni), C. remanei (Cre), C. japonica (Cja), C. tropicalis (Ctr), and P. pacificus (Ppa). Protein alignments were generated using SnapGene with default settings. The C. elegans residue G161 mutated in sc63 is highlighted with a red box.
    Sgrna Expression, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+expressing+cas9+++empty+sgrna/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pmc11333045-310-8-19
    Average 95 stars, based on 1 article reviews
    sgrna expression - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    cas9 expressing plasmid  (Addgene inc)
    95
    Addgene inc cas9 expressing plasmid
    (A) Schematic representation of the sqt-3 coding strand from amino acid residues 153 to 169, with the wild-type sequence on top and the edited sequence at the bottom. The sc63 mutation (G161E) is indicated in red. The gRNA sequences are marked with black arrows, and the adjacent PAM sequences are underlined. Additional silent mutations introduced by the single-stranded DNA repair template create SfoI or HaeII restriction sites for ease of screening, which are highlighted with a yellow background. Silent mutations introduced to disrupt gRNA complementarity and prevent re-editing are shown in blue. The expected <t>Cas9</t> cleavage sites are marked by vertical red dashed lines. (B) Representative images of Roller (left), Dumpy (middle), and Dumpy/Roller (right) phenotypes in F1 adult progeny of injected animals grown at 25°C. Individuals with the corresponding phenotype were placed in proximity to each other for imaging. Images were captured using a Leica DFC3000 G camera with a 20x objective. Scale bar: 1500 µm. (C) Summary of editing efficiency with each gRNA. About 20 animals were injected for each condition, resulting in 6–9 individuals producing edited F1 offspring at 25°C. (D) Alignment of SQT-3 amino acid residues 153–169 of C. elegans (Cel) to the homologous proteins in C. brenneri (Cbn), C. briggsae (Cbr), C. nigoni (Cni), C. remanei (Cre), C. japonica (Cja), C. tropicalis (Ctr), and P. pacificus (Ppa). Protein alignments were generated using SnapGene with default settings. The C. elegans residue G161 mutated in sc63 is highlighted with a red box.
    Cas9 Expressing Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+expressing+cas9+++empty+sgrna/pDD162+(Peft-3%3A%3ACas9+%2B+Empty+sgRNA)+(Plasmid+%2347549)/pmc08491880-418-1-5
    Average 95 stars, based on 1 article reviews
    cas9 expressing plasmid - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    (A) Schematic representation of the sqt-3 coding strand from amino acid residues 153 to 169, with the wild-type sequence on top and the edited sequence at the bottom. The sc63 mutation (G161E) is indicated in red. The gRNA sequences are marked with black arrows, and the adjacent PAM sequences are underlined. Additional silent mutations introduced by the single-stranded DNA repair template create SfoI or HaeII restriction sites for ease of screening, which are highlighted with a yellow background. Silent mutations introduced to disrupt gRNA complementarity and prevent re-editing are shown in blue. The expected Cas9 cleavage sites are marked by vertical red dashed lines. (B) Representative images of Roller (left), Dumpy (middle), and Dumpy/Roller (right) phenotypes in F1 adult progeny of injected animals grown at 25°C. Individuals with the corresponding phenotype were placed in proximity to each other for imaging. Images were captured using a Leica DFC3000 G camera with a 20x objective. Scale bar: 1500 µm. (C) Summary of editing efficiency with each gRNA. About 20 animals were injected for each condition, resulting in 6–9 individuals producing edited F1 offspring at 25°C. (D) Alignment of SQT-3 amino acid residues 153–169 of C. elegans (Cel) to the homologous proteins in C. brenneri (Cbn), C. briggsae (Cbr), C. nigoni (Cni), C. remanei (Cre), C. japonica (Cja), C. tropicalis (Ctr), and P. pacificus (Ppa). Protein alignments were generated using SnapGene with default settings. The C. elegans residue G161 mutated in sc63 is highlighted with a red box.

    Journal: microPublication Biology

    Article Title: sqt-3(sc63) is an alternative CRISPR/Cas9 co-conversion marker in Caenorhabditis elegans

    doi: 10.17912/micropub.biology.001467

    Figure Lengend Snippet: (A) Schematic representation of the sqt-3 coding strand from amino acid residues 153 to 169, with the wild-type sequence on top and the edited sequence at the bottom. The sc63 mutation (G161E) is indicated in red. The gRNA sequences are marked with black arrows, and the adjacent PAM sequences are underlined. Additional silent mutations introduced by the single-stranded DNA repair template create SfoI or HaeII restriction sites for ease of screening, which are highlighted with a yellow background. Silent mutations introduced to disrupt gRNA complementarity and prevent re-editing are shown in blue. The expected Cas9 cleavage sites are marked by vertical red dashed lines. (B) Representative images of Roller (left), Dumpy (middle), and Dumpy/Roller (right) phenotypes in F1 adult progeny of injected animals grown at 25°C. Individuals with the corresponding phenotype were placed in proximity to each other for imaging. Images were captured using a Leica DFC3000 G camera with a 20x objective. Scale bar: 1500 µm. (C) Summary of editing efficiency with each gRNA. About 20 animals were injected for each condition, resulting in 6–9 individuals producing edited F1 offspring at 25°C. (D) Alignment of SQT-3 amino acid residues 153–169 of C. elegans (Cel) to the homologous proteins in C. brenneri (Cbn), C. briggsae (Cbr), C. nigoni (Cni), C. remanei (Cre), C. japonica (Cja), C. tropicalis (Ctr), and P. pacificus (Ppa). Protein alignments were generated using SnapGene with default settings. The C. elegans residue G161 mutated in sc63 is highlighted with a red box.

    Article Snippet: The Cas9 worm expression plasmid (pDD162, #47549) and empty vector for gRNA cloning (pRB1017, #59936) were obtained from Addgene .

    Techniques: CRISPR, Sequencing, Mutagenesis, Injection, Imaging, Generated, Residue

    Journal: microPublication Biology

    Article Title: sqt-3(sc63) is an alternative CRISPR/Cas9 co-conversion marker in Caenorhabditis elegans

    doi: 10.17912/micropub.biology.001467

    Figure Lengend Snippet:

    Article Snippet: The Cas9 worm expression plasmid (pDD162, #47549) and empty vector for gRNA cloning (pRB1017, #59936) were obtained from Addgene .

    Techniques: Concentration Assay, Expressing, Plasmid Preparation